Filters
Technology
Platform
GSE47220
Mus musculus, Homo sapiens
13 Downloadable Samples
Illumina MouseWG-6 v2.0 expression beadchip, Illumina MouseRef-8 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Age, Specimen part, Cell line, Treatment
View Samples- Mus musculus
- 3 Downloadable Samples
Illumina MouseRef-8 v2.0 expression beadchip, Illumina MouseWG-6 v2.0 expression beadchip
Description
We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 4 Downloadable Samples
Illumina HiSeq 2500
Description
Half of prostate cancers are caused by a gene-fusion that enables androgens to drive expression of the normally silent ETS transcription factor ERG in luminal prostate cells1-4. Recent prostate cancer genomic landscape studies5-10 have reported rare but recurrent point mutations in the ETS repressor ERF11. Here we show these ERF mutations cause decreased protein stability and ERF mutant tumours are mostly exclusive from those with ERG fusions. ERF loss recapitulates the morphologic and phenotypic features of ERG gain in primary mouse prostate tissue, including expansion of the androgen receptor (AR) transcriptional repertoire, and ERF has tumour suppressor activity in the same genetic background of PTEN loss that yields oncogenic activity by ERG. Furthermore, in a human prostate cancer model of ERG gain and wild-type ERF, ChIP-seq studies indicate that ERG inhibits the ability of ERF to bind DNA at consensus ETS sites. Consistent with a competition model, ERF loss rescues ERG-positive prostate cancer cells from ERG dependency. Collectively, these data provide evidence that the oncogenicity of ERG is mediated, in part, by displacement of ERF and raise the larger question of whether other gain-of-function oncogenic transcription factors might also inactivate endogenous tumour suppressors. Overall design: Murine Pten+/+ prostates were infected with shNT or shErf lentivirus, selected with antibiotics and 2 rounds of FACS. For each condition, 2 sets of equal numbers of cells were plated and then processed for RNA extraction and RNA-seq independently.
Publication Title
ERF mutations reveal a balance of ETS factors controlling prostate oncogenesis.
Sample Metadata Fields
Subject
View Samples