Filters
Technology
Platform
Homo sapiens
24 Downloadable Samples
Affymetrix Human Genome U133A 2.0 Array (hgu133a2)
Description
Elevated levels of androgen receptor (AR) in prostate cancer confer resistance to current antiandrogens and play a causal role in disease progression due to persistent target gene activation. Through pharmacologic and genetic approaches, we show that half of all direct AR target genes, including TMPRSS2, the primary driver of ETS fusion transcripts in 70 percent of human prostate cancers, require histone deacetylase (HDAC) activity for transcriptional activation by AR. Surprisingly, the HDAC3-NCoR complex, which typically functions to repress gene expression by nuclear receptors, is required for AR target gene activation. Prostate cancer cells treated with HDAC inhibitors have reduced AR protein levels, but we show that the mechanism of blockade of AR activity is through failure to assemble a coactivator/RNA polymerase II complex after AR binds to the enhancers of target genes. Failed complex assembly is associated with a phase shift in the cyclical wave of AR recruitment that typically occurs in response to ligand treatment. HDAC inhibitors retain the ability to block AR activity in hormone refractory prostate cancer models and therefore merit clinical investigation in this setting. HDAC-regulated AR target genes defined here can serve as biomarkers to ensure sufficient levels of HDAC inhibition.
Publication Title
Histone deacetylases are required for androgen receptor function in hormone-sensitive and castrate-resistant prostate cancer.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 19 Downloadable Samples
- Affymetrix Human Genome U133A 2.0 Array (hgu133a2)
Description
Elevated levels of androgen receptor (AR) in prostate cancer confer resistance to current antiandrogens and play a causal role in disease progression due to persistent target gene activation. Through pharmacologic and genetic approaches, we show that half of all direct AR target genes, including TMPRSS2, the primary driver of ETS fusion transcripts in 70 percent of human prostate cancers, require histone deacetylase (HDAC) activity for transcriptional activation by AR. Surprisingly, the HDAC3-NCoR complex, which typically functions to repress gene expression by nuclear receptors, is required for AR target gene activation. Prostate cancer cells treated with HDAC inhibitors have reduced AR protein levels, but we show that the mechanism of blockade of AR activity is through failure to assemble a coactivator/RNA polymerase II complex after AR binds to the enhancers of target genes. Failed complex assembly is associated with a phase shift in the cyclical wave of AR recruitment that typically occurs in response to ligand treatment. HDAC inhibitors retain the ability to block AR activity in hormone refractory prostate cancer models and therefore merit clinical investigation in this setting. HDAC-regulated AR target genes defined here can serve as biomarkers to ensure sufficient levels of HDAC inhibition.
Publication Title
Histone deacetylases are required for androgen receptor function in hormone-sensitive and castrate-resistant prostate cancer.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 153 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Over one million prostate biopsies are performed in the U.S. every year. However, pathology examination is not definitive in a significant percentage of cases due limited diagnostic tumor. We have observed that the microenvironment of prostate tumor cells exhibits numerous differential gene expression changes and have asked whether such information can be used to distinguish tumor from nontumor. We initially compared expression analysis data (Affymetrix U133plus2) from 18 volunteer biopsy specimens to 17 specimens containing largely tumor-adjacent stroma and identified 964 significant (p_adj < 0.01 and B > 0) expression changes. These genes were filtered to eliminate possible aging-related genes and genes expressed in tumor cells > 10% of the stroma cell expression level leading to 23 candidate genes (28 Affymetrix probe sets). A classifier based on the 28 probe sets was tested on 289 independent cases, including 195 tumor-bearing cases, 99 nontumor cases (normal biopsies, normal autopsies, remote stroma as well as pure tumor adjacent stroma) all with accuracies >85%, sensitivities >90% and specificities >85%. These results indicate that the prostate cancer microenvironment exhibits reproducible changes useful for categorization as tumor and nontumor.
Publication Title
In silico estimates of tissue components in surgical samples based on expression profiling data.
Sample Metadata Fields
Subject
View Samples- Homo sapiens
- 125 Downloadable Samples
- Affymetrix Human Genome U133A Array (hgu133a)
Description
Prostate cancer gene expression profiles were studied in this project. A total RNA from 148 prostate sample with various amount of different cell types were hybridized to Affymetrix U133A arrays. The percentage of different cell types vary considerably among samples and were determined by pathologist. Cell type specific genes can be determined by linear regression using the methods of Stuart et al, PNAS, 2004.
Publication Title
In silico estimates of tissue components in surgical samples based on expression profiling data.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus, Homo sapiens
- 13 Downloadable Samples
- Illumina MouseWG-6 v2.0 expression beadchip, Illumina MouseRef-8 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Age, Specimen part, Cell line, Treatment
View Samples- Homo sapiens
- 18 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Mus musculus
- 3 Downloadable Samples
Illumina MouseRef-8 v2.0 expression beadchip, Illumina MouseWG-6 v2.0 expression beadchip
Description
We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 12 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Cell line
View Samples
GSE22433- Homo sapiens
- 6 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
Gastrointestinal Stromal Tumor frequently harbor mutations in the KIT receptor tyrosine kinase and depend on its activity for growth. This underlies the efficacy of imatinib, a inhibitor of KIT activity, in GIST management. GIST882 is a patient derived GIST cell line that harbor a K640E exon 13 KIT mutation and is sensitive to imatinib treatment. To analyze the downstream effect of KIT inhibition, GIST882 cells were treated for 8 hours with 1M Imatinib.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Cell line
View Samples